Kung Lao Kenshi Bitcoin Dog - Mix of Maltese, German Shepard, Yorkshire Terrier, Corgi, Schnauzer, Shiba Inu, Pitbull terrier, Grey Wolf and Pug
Kung Lao Kenshi
  • Purity 7%
  • Age 8 months
  • Racing Exp 1
  • Maltese 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Hullo. My name is Kung Lao Kenshi. I live in cyberspace. I've always had a crush on Lassie. I believe running along the beach to catch a stick can be nearly orgasmic. Power outages and computer viruses scare me! As a perfectionist, I have to find just the right 'spot'.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.83 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TTAAGCACCACCATAGTATCATCATCCCCCGAA
T
T
A
A
G
C
A
C
C
A
C
C
A
T
A
G
T
A
T
C
A
T
C
A
T
C
C
C
C
C
G
A
A
Genes: FOKKCE77NL2

Composition

Maltese
18%
German Shepard
18%
Yorkshire Terrier
9%
Corgi
9%
Schnauzer
9%
Shiba Inu
9%
Pitbull terrier
9%
Grey Wolf
9%
Pug
9%

Current Energy

Vitality -70 points
Lunar Effect +6 points

Traits Breakdown

Body Yorkshire Terrier
Tail Corgi
Legs Maltese
Front Legs Maltese
Head Schnauzer
Ears Shiba Inu
Snout German Shepard
Mouth German Shepard
Nose Pitbull terrier
Eyes Grey Wolf
Color Pug

Parents

No Children

Photos

Gift