Berry Brutus Crypto Dog - Mix of Dachshund, Yorkshire Terrier, Pug, Boxer, Poodle, St. Bernard, Grey Wolf and Golder Retriever
Berry Brutus
  • Purity 4%
  • Age 6 months
  • Racing Exp 8
  • Dachshund 18%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 2 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I slept with a cat and I liked it. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew. I'm not into dog collars, unless you're into S & M. My favorite sport is catching treats my human throws!

Racing Stats

Ran 2 races
  • 0 1 0
 Best Time15.98 sec
No rank  RacingĀ *** LTC
50.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GGATTAAACGACGAATTATGAGGACCCGAAAGA
G
G
A
T
T
A
A
A
C
G
A
C
G
A
A
T
T
A
T
G
A
G
G
A
C
C
C
G
A
A
A
G
A
Genes: AFGI2FBAL28

Composition

Dachshund
18%
Yorkshire Terrier
18%
Pug
18%
Boxer
9%
Poodle
9%
St. Bernard
9%
Grey Wolf
9%
Golder Retriever
9%

Current Energy

Vitality -50 points
Lunar Effect -18 points

Traits Breakdown

Body Dachshund
Tail Yorkshire Terrier
Legs Boxer
Front Legs Poodle
Head Pug
Ears Yorkshire Terrier
Snout St. Bernard
Mouth Dachshund
Nose Grey Wolf
Eyes Pug
Color Golder Retriever

Parents

No Children

Photos

cryptocurrency canine race results
Gift