Jade Jeep Litecoin Game Dog - Mix of Schnauzer, Pug, German Shepard, Grey Wolf, Maltese, Dachshund, Yorkshire Terrier, Beagle and Corgi
Jade Jeep
  • Purity 3%
  • Age 4 months
  • Racing Exp 10
  • Schnauzer 18%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 3 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Jade Jeep is the name, love is my game. And fetch of course... My favorite song is "Who Let the Dogs Out?" It was me :) I'm always up for some puppy action, is that wrong? I prefer lounging around the house. Nothing beats the midday sunbeam on the couch!

Racing Stats

Ran 3 races
  • 1 0 0
 Best Time15.13 sec
No rank  RacingĀ *** LTC
33.3 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCACCCACCGGATTAATAGAACTAATAGAAAGC
T
C
A
C
C
C
A
C
C
G
G
A
T
T
A
A
T
A
G
A
A
C
T
A
A
T
A
G
A
A
A
G
C
Genes: 7LKAFC2DC2O

Composition

Schnauzer
18%
Pug
18%
German Shepard
9%
Grey Wolf
9%
Maltese
9%
Dachshund
9%
Yorkshire Terrier
9%
Beagle
9%
Corgi
9%

Current Energy

Vitality -47 points
Lunar Effect -2 points

Traits Breakdown

Body German Shepard
Tail Grey Wolf
Legs Maltese
Front Legs Dachshund
Head Yorkshire Terrier
Ears Schnauzer
Snout Pug
Mouth Beagle
Nose Schnauzer
Eyes Pug
Color Corgi

Parents

No Children

Photos

virtual pet race
Gift