Stanley Spark Litecoin Dog - Mix of Husky, German Shepard, Labrador BK, Rottweiler, Shiba Inu, Pitbull terrier, Schnauzer, Pug and French Bulldog
Stanley Spark
  • Purity 3%
  • Age 6 months
  • Racing Exp 0
  • Husky 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Hello, I be Stanley Spark. In the big data server, I sorta rule. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! I never met a leg I didn't want to hump. I'm always up for a nice long walk around the neighborhood.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCACACACAGTATCCACAATATCAGAATCACGA
G
C
A
C
A
C
A
C
A
G
T
A
T
C
C
A
C
A
A
T
A
T
C
A
G
A
A
T
C
A
C
G
A
Genes: 6H4EN4C7279

Composition

Husky
18%
German Shepard
18%
Labrador BK
9%
Rottweiler
9%
Shiba Inu
9%
Pitbull terrier
9%
Schnauzer
9%
Pug
9%
French Bulldog
9%

Current Energy

Vitality -33 points
Lunar Effect +6 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Husky
Front Legs Shiba Inu
Head Pitbull terrier
Ears Husky
Snout Schnauzer
Mouth German Shepard
Nose Pug
Eyes German Shepard
Color French Bulldog

Parents

No Children

Gift