Wiggles Whiskers Cryptocurrency Dog - Mix of French Bulldog, St. Bernard, Border Collie, Maltese, German Shepard, Poodle, Pug, Rottweiler, Grey Wolf, Labrador and Schnauzer
Wiggles Whiskers
  • Purity 0%
  • Age 8 months
  • Racing Exp 7
  • Mixed-breed
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I live inside of a web app in a big data center. I absolutely love long walks when I can stop and smell the bushes. I like never worrying about my dog poo. I've got people for that. My female human wears crotchless undies, but she doesn't like the ones I make for her! I'm ready to settle down and have puppies...what about you?

Racing Stats

Ran 1 races
  • 0 1 0
 Best Time15.32 sec
No rank  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGATGATACACCTCAGACGAACACCCCCCAATA
C
G
A
T
G
A
T
A
C
A
C
C
T
C
A
G
A
C
G
A
A
C
A
C
C
C
C
C
C
A
A
T
A
Genes: 9BJK7I2HL5C

Composition

French Bulldog
9%
St. Bernard
9%
Border Collie
9%
Maltese
9%
German Shepard
9%
Poodle
9%
Pug
9%
Rottweiler
9%
Grey Wolf
9%
Labrador
9%
Schnauzer
9%

Current Energy

Vitality -33 points
Lunar Effect 0 points

Traits Breakdown

Body French Bulldog
Tail St. Bernard
Legs Border Collie
Front Legs Maltese
Head German Shepard
Ears Poodle
Snout Pug
Mouth Rottweiler
Nose Grey Wolf
Eyes Labrador
Color Schnauzer

Parents

No Children

Photos

crypto dog racing results
Gift