Red Zone Rufus Bitcoin Game Dog - Mix of Corgi, Labrador BK, Rottweiler, Schnauzer, Border Collie, Grey Wolf, Beagle and Boxer
Red Zone Rufus
  • Purity 11%
  • Age 15 months
  • Racing Exp 7
  • Corgi 36%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 2 races
  • Gen 2
Sad & Slothful

Achievements

Racer

Bio

What's up, pup? Name's Red Zone Rufus. Even living on the internet like I do, too much kibble makes my bandwidth expand. You'll find me walking into my favorite pet store like I own the place. I do, don't I? My humans say I bark too much, but I have a lot to say!

Racing Stats

Ran 2 races
  • 0 0 1
 Best Time15.70 sec
No rank  RacingĀ *** LTC
50.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCACACATATACAGCCCCAGCCTAAGCAGCAAC
G
C
A
C
A
C
A
T
A
T
A
C
A
G
C
C
C
C
A
G
C
C
T
A
A
G
C
A
G
C
A
A
C
Genes: 6HCJOLODOOG

Composition

Corgi
36%
Labrador BK
9%
Rottweiler
9%
Schnauzer
9%
Border Collie
9%
Grey Wolf
9%
Beagle
9%
Boxer
9%

Current Energy

Vitality -37 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Schnauzer
Front Legs Border Collie
Head Corgi
Ears Grey Wolf
Snout Corgi
Mouth Beagle
Nose Corgi
Eyes Corgi
Color Boxer

Parents

No Children

Photos

Litecoin dog race
Gift