Tinker Turner Digital Cryptocurrency Dog - Mix of Schnauzer, Boxer, Dachshund, Pitbull terrier, St. Bernard, Labrador, Maltese and Yorkshire Terrier
Tinker Turner
  • Purity 6%
  • Age 2 months
  • Racing Exp 2
  • Schnauzer 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Hi, Tinker Turner is my name. I slept with a cat and I liked it. I believe running along the beach to catch a stick can be nearly orgasmic. I hate it when other dogs pee in my yard! IT'S MY YARD!! I want a mate that knows how to give a proper belly rub!

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time16.67 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AACATAGGAATATCCAACTGACCAACCTTAATA
A
A
C
A
T
A
G
G
A
A
T
A
T
C
C
A
A
C
T
G
A
C
C
A
A
C
C
T
T
A
A
T
A
Genes: GCACNGB5KFC

Composition

Schnauzer
27%
Boxer
18%
Dachshund
9%
Pitbull terrier
9%
St. Bernard
9%
Labrador
9%
Maltese
9%
Yorkshire Terrier
9%

Current Energy

Vitality -20 points
Lunar Effect -14 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs Dachshund
Front Legs Schnauzer
Head Pitbull terrier
Ears Boxer
Snout St. Bernard
Mouth Labrador
Nose Maltese
Eyes Yorkshire Terrier
Color Schnauzer