Lilo Lamborghini Virtual Crypto Game Dog - Mix of Husky, Labrador BK, Rottweiler, Schnauzer, Grey Wolf, Labrador, Pitbull terrier and Golder Retriever
Lilo Lamborghini
  • Purity 11%
  • Age 8 months
  • Racing Exp 13
  • Husky 36%
  • Gold medal 0 Silver medal 0 Bronze medal 2
  • 3 races
  • Gen 4
Depressed & Snaillike

Achievements

Racer

Bio

I'm having some new data architecture built for me, then I'd like to have you over to my place. I enjoy exploration and am game for anything doggy-style. I hate it when humans put the lid down. I've been solitary dog...looking for someone worth changing over.

Racing Stats

Ran 3 races
  • 0 0 2
 Best Time15.95 sec
No rank  RacingĀ *** LTC
66.7 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCACACACAATACCCCCAACATCCAGAACAACA
G
C
A
C
A
C
A
C
A
A
T
A
C
C
C
C
C
A
A
C
A
T
C
C
A
G
A
A
C
A
A
C
A
Genes: 6H4CL54N844

Composition

Husky
36%
Labrador BK
9%
Rottweiler
9%
Schnauzer
9%
Grey Wolf
9%
Labrador
9%
Pitbull terrier
9%
Golder Retriever
9%

Current Energy

Vitality -23 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Husky
Front Legs Schnauzer
Head Grey Wolf
Ears Labrador
Snout Husky
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Husky
Color Husky

Parents

No Children

Photos

Bitcoin dog race podium cryptocurrency doggy racing podium
Gift