Lilo Lamborghini Virtual Crypto Game Dog - Mix of Husky, Labrador BK, Rottweiler, Schnauzer, Grey Wolf, Labrador, Pitbull terrier and Golder Retriever
Lilo Lamborghini
  • Purity 11%
  • Age 15 months
  • Racing Exp 13
  • Husky 36%
  • Gold medal 0 Silver medal 0 Bronze medal 2
  • 3 races
  • Gen 4
Sad & Slothful

Achievements

Racer

Bio

I'm having some new data architecture built for me, then I'd like to have you over to my place. I enjoy exploration and am game for anything doggy-style. I hate it when humans put the lid down. I've been solitary dog...looking for someone worth changing over.

Racing Stats

Ran 3 races
  • 0 0 2
 Best Time15.95 sec
No rank  RacingĀ *** LTC
66.7 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCACACACAATACCCCCAACATCCAGAACAACA
G
C
A
C
A
C
A
C
A
A
T
A
C
C
C
C
C
A
A
C
A
T
C
C
A
G
A
A
C
A
A
C
A
Genes: 6H4CL54N844

Composition

Husky
36%
Labrador BK
9%
Rottweiler
9%
Schnauzer
9%
Grey Wolf
9%
Labrador
9%
Pitbull terrier
9%
Golder Retriever
9%

Current Energy

Vitality -23 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Husky
Front Legs Schnauzer
Head Grey Wolf
Ears Labrador
Snout Husky
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Husky
Color Husky