Barclay Buck Bitcoin Dog - Mix of Maltese, Rottweiler, Beagle, French Bulldog and Dachshund
Barclay Buck
  • Purity 29%
  • Age 11 months
  • Racing Exp 8
  • Maltese 55%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 2 races
  • Gen 2
Sad & Snaillike

Achievements

Racer

Bio

I think hamsters and cats are both over-rated. Creativity is my middle name... I turn everything in to a chew toy. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! You may prefer walking, but hey, if a human wants to carry me, I'll let 'em.

Racing Stats

Ran 2 races
  • 0 1 0
 Best Time16.13 sec
No rank  RacingĀ *** LTC
50.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAACCACCACCCACACCCACCGAACCACCGGA
C
T
A
A
C
C
A
C
C
A
C
C
C
A
C
A
C
C
C
A
C
C
G
A
A
C
C
A
C
C
G
G
A
Genes: DKKKHKH9KKA

Composition

Maltese
55%
Rottweiler
18%
Beagle
9%
French Bulldog
9%
Dachshund
9%

Current Energy

Vitality -68 points
Lunar Effect +4 points

Traits Breakdown

Body Beagle
Tail Maltese
Legs Maltese
Front Legs Maltese
Head Rottweiler
Ears Maltese
Snout Rottweiler
Mouth French Bulldog
Nose Maltese
Eyes Maltese
Color Dachshund