Solomon Schotzie Litecoin Dog - Mix of Rottweiler, Beagle, Schnauzer and Maltese
Solomon Schotzie
  • Purity 52%
  • Age 5 months
  • Racing Exp 1
  • Rottweiler 73%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer

Bio

Hey, Baby. I'm Solomon Schotzie. I really enjoy heavy petting. I hate it when my humans fool me with a pill in peanut butter! Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone. I adore sleeping upside down with my tongue hanging out!

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.48 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CACCACCACCACCACCACCACCTACACATAACC
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
T
A
C
A
C
A
T
A
A
C
C
Genes: HHHHHHHDHCK

Composition

Rottweiler
73%
Beagle
9%
Schnauzer
9%
Maltese
9%

Current Energy

Vitality -17 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Rottweiler
Front Legs Rottweiler
Head Rottweiler
Ears Rottweiler
Snout Rottweiler
Mouth Beagle
Nose Rottweiler
Eyes Schnauzer
Color Maltese

Parents

No Children

Photos

Gift