Tinker Trouble Bitcoin Dog - Pure German Shepard
Tinker Trouble
  • Purity 100%
  • Age 4 months
  • Racing Exp 12
  • German Shepard 100%
  • Gold medal 0 Silver medal 0 Bronze medal 2
  • 2 races
  • Gen 13
Depressed & Snaillike

Achievements

Racer

Bio

I live in cyberspace. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. If I can't reach it to clean it myself, it doesn't need cleaning! I'm looking for someone to make bath time a little more bearable!

Racing Stats

Ran 2 races
  • 0 0 2
 Best Time15.25 sec
No rank  RacingĀ *** LTC
100.0 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred German Shepard

Parents

No Children

Photos

online doggy race crypto dog race
Gift