Capone Chica Crypto Dog - Mix of Poodle, Corgi, Labrador BK, Rottweiler, Husky, Border Collie, Beagle, Schnauzer and Boxer
Capone Chica
  • Purity 5%
  • Age 8 months
  • Racing Exp 255
  • Poodle 18%
  • Gold medal 8 Silver medal 13 Bronze medal 12
  • 61 races
  • Gen 1
Depressed & Snaillike

Achievements

Podium Champion
Pro Racer
Master Champion
Speed Champion
TOP 10 Fastest

Bio

I'm Capone Chica and I'd like to show you a trick or two. I live in cyberspace. I hate it when my humans fool me with a pill in peanut butter! I never met a crotch or a butt I didn't like, but I'm just friendly that way. I'm looking for someone to share my collection of artisan rawhide with!

Racing Stats

Ran 61 races
  • 8 13 12
 Best Time13.78 sec
Rank 10  RacingĀ *** LTC
54.1 % wins (33) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCACACACATACGACGACAGCCTAAGCATAAAC
G
C
A
C
A
C
A
C
A
T
A
C
G
A
C
G
A
C
A
G
C
C
T
A
A
G
C
A
T
A
A
A
C
Genes: 6H4JIIODOCG

Composition

Poodle
18%
Corgi
18%
Labrador BK
9%
Rottweiler
9%
Husky
9%
Border Collie
9%
Beagle
9%
Schnauzer
9%
Boxer
9%

Current Energy

Vitality -16 points
Lunar Effect +2 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Husky
Front Legs Border Collie
Head Poodle
Ears Poodle
Snout Corgi
Mouth Beagle
Nose Corgi
Eyes Schnauzer
Color Boxer