Endzone Elena Bitcoin Game Dog - Mix of Maltese, Beagle, Labrador, Rottweiler, Husky, Grey Wolf and Border Collie
Endzone Elena
  • Purity 16%
  • Age 8 months
  • Racing Exp 1
  • Maltese 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

My humans say I bark too much, but I have a lot to say! My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I like to play fetch with a tennis ball. Aggressive dogs that don't let 'me be me' frustrate me.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.25 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAACCCCAACCCACACCACACCCACCACCTAC
C
T
A
A
C
C
C
C
A
A
C
C
C
A
C
A
C
C
A
C
A
C
C
C
A
C
C
A
C
C
T
A
C
Genes: DK5KHK4LKKJ

Composition

Maltese
45%
Beagle
9%
Labrador
9%
Rottweiler
9%
Husky
9%
Grey Wolf
9%
Border Collie
9%

Current Energy

Vitality -46 points
Lunar Effect +8 points

Traits Breakdown

Body Beagle
Tail Maltese
Legs Labrador
Front Legs Maltese
Head Rottweiler
Ears Maltese
Snout Husky
Mouth Grey Wolf
Nose Maltese
Eyes Maltese
Color Border Collie