Stewie Sarge Cryptocurrency Dog - Mix of Rottweiler, Schnauzer, Grey Wolf, Beagle and Maltese
Stewie Sarge
  • Purity 23%
  • Age 18 months
  • Racing Exp 0
  • Rottweiler 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Sad & Tardy

Achievements

None

Bio

How's it going? I'm Stewie Sarge. I live inside of a Virtual machine two steps to the right from the firewall. I hate it when my humans fool me with a pill in peanut butter! Slipping my collar, running off and making my humans worried? Every chance I get. I'm looking for a poodle in the streets, and a bulldog in the sheets!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CACCACCACATACACCCCCCCCTACACATAACC
C
A
C
C
A
C
C
A
C
A
T
A
C
A
C
C
C
C
C
C
C
C
T
A
C
A
C
A
T
A
A
C
C
Genes: HHHCHLLDHCK

Composition

Rottweiler
45%
Schnauzer
18%
Grey Wolf
18%
Beagle
9%
Maltese
9%

Current Energy

Vitality -44 points
Lunar Effect -4 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Rottweiler
Front Legs Schnauzer
Head Rottweiler
Ears Grey Wolf
Snout Grey Wolf
Mouth Beagle
Nose Rottweiler
Eyes Schnauzer
Color Maltese