Digby Darwin Litecoin Dog - Mix of Maltese, Beagle, Labrador, Rottweiler, Husky, Schnauzer, Boxer, Dachshund and Border Collie
Digby Darwin
  • Purity 4%
  • Age 16 months
  • Racing Exp 7
  • Maltese 27%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 1 races
  • Gen 0
Neutral & Casual

Achievements

Racer

Bio

Salutations! My name's Digby Darwin. I run on the information superhighway and haven't been hit by a car yet. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I hate it when humans put the lid down. When my human brushes my coat, I get frisky!

Racing Stats

Ran 1 races
  • 0 1 0
 Best Time15.08 sec
No rank  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAACCCCAACCCACACCACAATAAACGGATAC
C
T
A
A
C
C
C
C
A
A
C
C
C
A
C
A
C
C
A
C
A
A
T
A
A
A
C
G
G
A
T
A
C
Genes: DK5KHK4CGAJ

Composition

Maltese
27%
Beagle
9%
Labrador
9%
Rottweiler
9%
Husky
9%
Schnauzer
9%
Boxer
9%
Dachshund
9%
Border Collie
9%

Current Energy

Vitality -46 points
Lunar Effect +8 points

Traits Breakdown

Body Beagle
Tail Maltese
Legs Labrador
Front Legs Maltese
Head Rottweiler
Ears Maltese
Snout Husky
Mouth Schnauzer
Nose Boxer
Eyes Dachshund
Color Border Collie