Nibby-Nose Nick Crypto Dog - Mix of Pug, French Bulldog, Labrador, Grey Wolf, Poodle, Border Collie, Labrador BK, Husky, Shiba Inu and St. Bernard
Nibby-Nose Nick
  • Purity 1%
  • Age 9 months
  • Racing Exp 0
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

My 'G' spot is under my chin...scratch me there and I'll growl softly. I enjoy crunchy kibble and drinking from toilets. I absolutely love long walks when I can stop and smell the bushes. I don't like having to stay in the car when my people go inside.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGACCACCCGACTACGAAGCAACAGTATGAGAA
C
G
A
C
C
A
C
C
C
G
A
C
T
A
C
G
A
A
G
C
A
A
C
A
G
T
A
T
G
A
G
A
A
Genes: 95LIJ264EB2

Composition

Pug
18%
French Bulldog
9%
Labrador
9%
Grey Wolf
9%
Poodle
9%
Border Collie
9%
Labrador BK
9%
Husky
9%
Shiba Inu
9%
St. Bernard
9%

Current Energy

Vitality -15 points
Lunar Effect -8 points

Traits Breakdown

Body French Bulldog
Tail Labrador
Legs Grey Wolf
Front Legs Poodle
Head Border Collie
Ears Pug
Snout Labrador BK
Mouth Husky
Nose Shiba Inu
Eyes St. Bernard
Color Pug

Parents

No Children

Gift