June Joker Digital Cryptocurrency Dog - Mix of Border Collie, Corgi, Labrador BK and Schnauzer
June Joker
  • Purity 39%
  • Age 4 months
  • Racing Exp 14
  • Border Collie 64%
  • Gold medal 1 Silver medal 0 Bronze medal 1
  • 2 races
  • Gen 10
Depressed & Snaillike

Achievements

Racer

Bio

Hey there... I'm June Joker. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! I enjoy going to the dog park to see all my friends! I'm looking for a poodle in the streets, and a bulldog in the sheets!

Racing Stats

Ran 2 races
  • 1 0 1
 Best Time14.65 sec
No rank  RacingĀ *** LTC
100.0 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTACAGCTACTACAGCTACTACGCAATATAC
T
A
C
T
A
C
A
G
C
T
A
C
T
A
C
A
G
C
T
A
C
T
A
C
G
C
A
A
T
A
T
A
C
Genes: JJOJJOJJ6CJ

Composition

Border Collie
64%
Corgi
18%
Labrador BK
9%
Schnauzer
9%

Current Energy

Vitality -14 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Corgi
Front Legs Border Collie
Head Border Collie
Ears Corgi
Snout Border Collie
Mouth Border Collie
Nose Labrador BK
Eyes Schnauzer
Color Border Collie

Parents

No Children

Photos

online canine race photo virtual dog racing podium
Gift