Mamie Mango Bitcoin Dog - Mix of Border Collie, Labrador, Husky, German Shepard and French Bulldog
Mamie Mango
  • Purity 38%
  • Age 6 months
  • Racing Exp 1
  • Border Collie 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 9
Depressed & Snaillike

Achievements

Racer

Bio

Even living on the internet like I do, too much kibble makes my bandwidth expand. I'll be honest...Napping is my favorite so we gotta go slow. I'm into leather...if I have the right partner. I'd like to find a dawg to hang with, no pressure. We can always make puppies later.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.28 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTACTACTACTACCCAACATACTCATACCGA
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
C
C
A
A
C
A
T
A
C
T
C
A
T
A
C
C
G
A
Genes: JJJJJ54J7J9

Composition

Border Collie
64%
Labrador
9%
Husky
9%
German Shepard
9%
French Bulldog
9%

Current Energy

Vitality +8 points
Lunar Effect +8 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Border Collie
Front Legs Border Collie
Head Border Collie
Ears Labrador
Snout Husky
Mouth Border Collie
Nose German Shepard
Eyes Border Collie
Color French Bulldog

Parents

No Children

Photos

Gift