Ref Rags Crypto Game Dog - Pure German Shepard
Ref Rags
  • Purity 100%
  • Age 3 months
  • Racing Exp 11
  • German Shepard 100%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 4 races
  • Gen 13
Depressed & Snaillike

Achievements

Racer

Bio

Who's a good dog? Hopefully you! Ref Rags here. I am a web of clouds kind of dog. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! I'm on the lookout for someone willing to stop and smell the catpoop with me.

Racing Stats

Ran 4 races
  • 1 0 0
 Best Time15.07 sec
No rank  RacingĀ *** LTC
25.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred German Shepard

Parents

No Children

Photos

virtual pet racing
Gift