Rock Red Flag Litecoin Game Dog - Mix of German Shepard, Maltese and Border Collie
Rock Red Flag
  • Purity 65%
  • Age 12 months
  • Racing Exp 4
  • German Shepard 82%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 4 races
  • Gen 12
Sad & Tardy

Achievements

Racer

Bio

My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I've always had a crush on Lassie. My humans should try spending 8 hours a day in a crate! Forget plastic hotdogs...I'm into the classic chew toys like slippers. I just want to "share a bone"... ;)

Racing Stats

Ran 4 races
  • 0 0 0
 Best Time15.07 sec
Rank 47  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAACCTCATCATCATCATCATCATACTCATCA
T
C
A
A
C
C
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
A
C
T
C
A
T
C
A
Genes: 7K777777J77

Composition

German Shepard
82%
Maltese
9%
Border Collie
9%

Current Energy

Vitality -5 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Maltese
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose Border Collie
Eyes German Shepard
Color German Shepard