Leroy Lucas Crypto Dog - Mix of Husky, Boxer, Schnauzer, Grey Wolf, Labrador, Pitbull terrier and Golder Retriever
Leroy Lucas
  • Purity 18%
  • Age 3 months
  • Racing Exp 21
  • Husky 45%
  • Gold medal 0 Silver medal 0 Bronze medal 3
  • 6 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer

Bio

How goes it? I'm Leroy Lucas. I am really into starting howling wars with the neighborhood dogs. I'm the loudest! Hound Dog by Elvis is probably the best song ever written. I hate going to the vet and will do almost anything to avoid it. Those flying monkeys in the Wizard of Oz still scare me!

Racing Stats

Ran 6 races
  • 0 0 3
 Best Time14.67 sec
No rank  RacingĀ *** LTC
50.0 % wins (3) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAAACACAATACCCCCAACATCCAGAACAACA
A
C
A
A
A
C
A
C
A
A
T
A
C
C
C
C
C
A
A
C
A
T
C
C
A
G
A
A
C
A
A
C
A
Genes: 4G4CL54N844

Composition

Husky
45%
Boxer
9%
Schnauzer
9%
Grey Wolf
9%
Labrador
9%
Pitbull terrier
9%
Golder Retriever
9%

Current Energy

Vitality -25 points
Lunar Effect +12 points

Traits Breakdown

Body Husky
Tail Boxer
Legs Husky
Front Legs Schnauzer
Head Grey Wolf
Ears Labrador
Snout Husky
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Husky
Color Husky