Sektor Sheena Litecoin Dog - Mix of German Shepard, St. Bernard, Golder Retriever, Shiba Inu and Labrador
Sektor Sheena
  • Purity 17%
  • Age 4 months
  • Racing Exp 2
  • German Shepard 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 4
Depressed & Snaillike

Achievements

Racer

Bio

Currently, I live on the information superhighway. The smell of fresh manure to roll in makes me wild. I enjoy staying active, and running circles around puppies and young children. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary!

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time15.87 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATGATCAAGATGATCATGAGTACCATCATGA
T
C
A
T
G
A
T
C
A
A
G
A
T
G
A
T
C
A
T
G
A
G
T
A
C
C
A
T
C
A
T
G
A
Genes: 7B78B7BE57B

Composition

German Shepard
36%
St. Bernard
36%
Golder Retriever
9%
Shiba Inu
9%
Labrador
9%

Current Energy

Vitality -23 points
Lunar Effect +10 points

Traits Breakdown

Body German Shepard
Tail St. Bernard
Legs German Shepard
Front Legs Golder Retriever
Head St. Bernard
Ears German Shepard
Snout St. Bernard
Mouth Shiba Inu
Nose Labrador
Eyes German Shepard
Color St. Bernard