Kramer Kelsey Bitcoin Game Dog - Mix of Pug, Border Collie, Poodle, Shiba Inu, St. Bernard, Husky, Grey Wolf, Labrador BK, Labrador and French Bulldog
Kramer Kelsey
  • Purity 1%
  • Age 11 months
  • Racing Exp 0
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

I'm Kramer Kelsey. How goes it? Air Bud is definitely my favorite movie. What a role model! I love fetching anything my human throws! I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) I never met a leg I didn't want to hump.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACGACGTATGAGAAACAGAACCCGCACCACGA
T
A
C
G
A
C
G
T
A
T
G
A
G
A
A
A
C
A
G
A
A
C
C
C
G
C
A
C
C
A
C
G
A
Genes: JIEB242L659

Composition

Pug
18%
Border Collie
9%
Poodle
9%
Shiba Inu
9%
St. Bernard
9%
Husky
9%
Grey Wolf
9%
Labrador BK
9%
Labrador
9%
French Bulldog
9%

Current Energy

Vitality -44 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail Poodle
Legs Shiba Inu
Front Legs St. Bernard
Head Pug
Ears Husky
Snout Pug
Mouth Grey Wolf
Nose Labrador BK
Eyes Labrador
Color French Bulldog

Parents

No Children

Gift