Corvette Cupcake Digital Cryptocurrency Dog - Mix of Dachshund, Schnauzer, Maltese, Pug, German Shepard and Corgi
Corvette Cupcake
  • Purity 14%
  • Age 8 months
  • Racing Exp 160
  • Dachshund 27%
  • Gold medal 9 Silver medal 4 Bronze medal 5
  • 48 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Podium Champion
Master Champion

Bio

I like never worrying about my dog poo. I've got people for that. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! Spiked dog collars really turn me on. I hate it when my humans fart and they blame me!

Racing Stats

Ran 48 races
  • 9 4 5
 Best Time14.28 sec
Rank 30  RacingĀ *** LTC
37.5 % wins (18) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GGAGAAGGATCAATAACCACCAGCGGAATAATA
G
G
A
G
A
A
G
G
A
T
C
A
A
T
A
A
C
C
A
C
C
A
G
C
G
G
A
A
T
A
A
T
A
Genes: A2A7CKKOACC

Composition

Dachshund
27%
Schnauzer
27%
Maltese
18%
Pug
9%
German Shepard
9%
Corgi
9%

Current Energy

Vitality -37 points
Lunar Effect +6 points

Traits Breakdown

Body Dachshund
Tail Pug
Legs Dachshund
Front Legs German Shepard
Head Schnauzer
Ears Maltese
Snout Maltese
Mouth Corgi
Nose Dachshund
Eyes Schnauzer
Color Schnauzer

Parents

No Children

Photos

cryptocurrency canine race Litecoin doggy race photo virtual dog race results online pet racing Bitcoin dog race virtual doggy racing photo online canine racing photo online doggy race
Gift