Lucifer Louis Litecoin Dog - Mix of Shiba Inu, Yorkshire Terrier, Corgi, German Shepard, Dachshund, Golder Retriever and Grey Wolf
Lucifer Louis
  • Purity 9%
  • Age 4 months
  • Racing Exp 0
  • Shiba Inu 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Depressed & Snaillike

Achievements

None

Bio

What's up? I'm Lucifer Louis. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? I'm willing to try little bondage, so my human chained me up! The absolute best time of day is dinner time! I like nibbling on most everything, but I'll bite if you want me to.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATTAGGAAGAAGCCCCTTATCATCAAGCGTA
G
T
A
T
T
A
G
G
A
A
G
A
A
G
C
C
C
C
T
T
A
T
C
A
T
C
A
A
G
C
G
T
A
Genes: EFA8OLF77OE

Composition

Shiba Inu
18%
Yorkshire Terrier
18%
Corgi
18%
German Shepard
18%
Dachshund
9%
Golder Retriever
9%
Grey Wolf
9%

Current Energy

Vitality -48 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Yorkshire Terrier
Legs Dachshund
Front Legs Golder Retriever
Head Corgi
Ears Grey Wolf
Snout Yorkshire Terrier
Mouth German Shepard
Nose German Shepard
Eyes Corgi
Color Shiba Inu