Opie Orson Crypto Dog - Mix of Border Collie, Dachshund, Labrador, Husky, Labrador BK and Schnauzer
Opie Orson
  • Purity 27%
  • Age 5 months
  • Racing Exp 0
  • Border Collie 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 9
Depressed & Snaillike

Achievements

None

Bio

I'm a super-dog in the internet universe. I'm always up for some puppy action, is that wrong? I like to play fetch with a tennis ball. As a designer, I suggest low windows or couch backs next to windows without curtains. I don't like running outta pee when there are still so many trees.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTACGGATACTACCCAACATACGCAATATAC
T
A
C
T
A
C
G
G
A
T
A
C
T
A
C
C
C
A
A
C
A
T
A
C
G
C
A
A
T
A
T
A
C
Genes: JJAJJ54J6CJ

Composition

Border Collie
55%
Dachshund
9%
Labrador
9%
Husky
9%
Labrador BK
9%
Schnauzer
9%

Current Energy

Vitality -14 points
Lunar Effect +8 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Dachshund
Front Legs Border Collie
Head Border Collie
Ears Labrador
Snout Husky
Mouth Border Collie
Nose Labrador BK
Eyes Schnauzer
Color Border Collie