Mabel Maddie Bitcoin Dog - Mix of Pitbull terrier, Boxer, Schnauzer, Grey Wolf, Rottweiler and Yorkshire Terrier
Mabel Maddie
  • Purity 14%
  • Age 5 months
  • Racing Exp 108
  • Pitbull terrier 27%
  • Gold medal 2 Silver medal 7 Bronze medal 4
  • 32 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Podium Champion
Master Champion

Bio

I'm Mabel Maddie and I'd like to show you a trick or two. My humans say I bark too much, but I have a lot to say! I enjoy staying active, and running circles around puppies and young children. My human is my best friend, looking for someone who is okay with that.

Racing Stats

Ran 32 races
  • 2 7 4
 Best Time14.32 sec
No rank  RacingĀ *** LTC
40.6 % wins (13) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCCAACAACATAATATCCCCCAACTCCCACTTA
T
C
C
A
A
C
A
A
C
A
T
A
A
T
A
T
C
C
C
C
C
A
A
C
T
C
C
C
A
C
T
T
A
Genes: NGGCCNLGNHF

Composition

Pitbull terrier
27%
Boxer
27%
Schnauzer
18%
Grey Wolf
9%
Rottweiler
9%
Yorkshire Terrier
9%

Current Energy

Vitality -55 points
Lunar Effect +2 points

Traits Breakdown

Body Pitbull terrier
Tail Boxer
Legs Boxer
Front Legs Schnauzer
Head Schnauzer
Ears Pitbull terrier
Snout Grey Wolf
Mouth Boxer
Nose Pitbull terrier
Eyes Rottweiler
Color Yorkshire Terrier

Parents

No Children

Photos

virtual canine race podium virtual dog race crypto doggy racing cryptocurrency canine racing photo online dog race crypto dog racing podium Bitcoin dog racing podium virtual pet racing results
Gift