Kibbles Knuckles Crypto Game Dog - Mix of St. Bernard, Rottweiler, Border Collie, Schnauzer, Maltese, Pug, Shiba Inu and German Shepard
Kibbles Knuckles
  • Purity 6%
  • Age 12 months
  • Racing Exp 6
  • St. Bernard 27%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 1 races
  • Gen 1
Sad & Tardy

Achievements

Racer

Bio

I hate it when other dogs pee in my yard! IT'S MY YARD!! I don't mind sharing my bed with someone I just met, if we can cuddle. What's your favorite bed? Mine is the dirty laundry. Size doesn't matter, I like 'em all.

Racing Stats

Ran 1 races
  • 0 0 1
 Best Time16.00 sec
No rank  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTGACACATATGAACCGAAGTACACTCATGA
T
A
C
T
G
A
C
A
C
A
T
A
T
G
A
A
C
C
G
A
A
G
T
A
C
A
C
T
C
A
T
G
A
Genes: JBHCBK2EH7B

Composition

St. Bernard
27%
Rottweiler
18%
Border Collie
9%
Schnauzer
9%
Maltese
9%
Pug
9%
Shiba Inu
9%
German Shepard
9%

Current Energy

Vitality -44 points
Lunar Effect +6 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs Rottweiler
Front Legs Schnauzer
Head St. Bernard
Ears Maltese
Snout Pug
Mouth Shiba Inu
Nose Rottweiler
Eyes German Shepard
Color St. Bernard