Ender Eddy Bitcoin Dog - Mix of Shiba Inu, Husky, Beagle, Golder Retriever, Pitbull terrier, Yorkshire Terrier and Rottweiler
Ender Eddy
  • Purity 14%
  • Age 4 months
  • Racing Exp 1
  • Shiba Inu 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 8
Depressed & Snaillike

Achievements

Racer

Bio

It's a barkin' beautiful day! Ender Eddy here. The cloud's my neighborhood. I love unconditionally. My turn-offs are rolled up newspapers and loud noises. I've always had a crush on Lassie. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title!

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.72 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAAGAACAGTAGTAGTAACATCCTTAGTACAC
C
T
A
A
G
A
A
C
A
G
T
A
G
T
A
G
T
A
A
C
A
T
C
C
T
T
A
G
T
A
C
A
C
Genes: D84EEE4NFEH

Composition

Shiba Inu
36%
Husky
18%
Beagle
9%
Golder Retriever
9%
Pitbull terrier
9%
Yorkshire Terrier
9%
Rottweiler
9%

Current Energy

Vitality -28 points
Lunar Effect +6 points

Traits Breakdown

Body Beagle
Tail Golder Retriever
Legs Husky
Front Legs Shiba Inu
Head Shiba Inu
Ears Shiba Inu
Snout Husky
Mouth Pitbull terrier
Nose Yorkshire Terrier
Eyes Shiba Inu
Color Rottweiler

Parents

No Children

Photos

Gift