Ozzy Pawsborne Odie Cryptocurrency Dog - Mix of German Shepard, Grey Wolf, Boxer and Maltese
Ozzy Pawsborne Odie
  • Purity 35%
  • Age 16 months
  • Racing Exp 1
  • German Shepard 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 11
Happy & Agile

Achievements

Racer

Bio

I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.50 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAAACTCATCATCACCCCCCCCCTCATCAACC
T
C
A
A
A
C
T
C
A
T
C
A
T
C
A
C
C
C
C
C
C
C
C
C
T
C
A
T
C
A
A
C
C
Genes: 7G777LLL77K

Composition

German Shepard
55%
Grey Wolf
27%
Boxer
9%
Maltese
9%

Current Energy

Vitality -11 points
Lunar Effect +8 points

Traits Breakdown

Body German Shepard
Tail Boxer
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Grey Wolf
Snout Grey Wolf
Mouth Grey Wolf
Nose German Shepard
Eyes German Shepard
Color Maltese