Yukon Yoda Litecoin Dog - Mix of German Shepard, Husky and Golder Retriever
Yukon Yoda
  • Purity 65%
  • Age 9 months
  • Racing Exp 19
  • German Shepard 82%
  • Gold medal 2 Silver medal 0 Bronze medal 0
  • 5 races
  • Gen 12
Depressed & Snaillike

Achievements

Racer

Bio

Hello, I'm Yukon Yoda. How's it goin'? I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I'm into group dog piles, the more the better. I like never worrying about my dog poo. I've got people for that.

Racing Stats

Ran 5 races
  • 2 0 0
 Best Time14.12 sec
Rank 17  RacingĀ *** LTC
40.0 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATCAACATCATCATCATCATCATCAAGATCA
T
C
A
T
C
A
A
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
A
G
A
T
C
A
Genes: 77477777787

Composition

German Shepard
82%
Husky
9%
Golder Retriever
9%

Current Energy

Vitality -3 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs Husky
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose German Shepard
Eyes Golder Retriever
Color German Shepard