Skip Simon Litecoin Game Dog - Mix of Border Collie, Grey Wolf, Labrador, Husky, German Shepard, Schnauzer and Rottweiler
Skip Simon
  • Purity 18%
  • Age 6 months
  • Racing Exp 0
  • Border Collie 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 8
Depressed & Snaillike

Achievements

None

Bio

Top o' the mornin' to ya! I'm Skip Simon. The Ethernet where I live, rocks. My favorite place in the world is the dog park. So many smells! Let me have a pig's ear and I'm in heaven. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTACCCCTACTACCCAACATACTCAATACAC
T
A
C
T
A
C
C
C
C
T
A
C
T
A
C
C
C
A
A
C
A
T
A
C
T
C
A
A
T
A
C
A
C
Genes: JJLJJ54J7CH

Composition

Border Collie
45%
Grey Wolf
9%
Labrador
9%
Husky
9%
German Shepard
9%
Schnauzer
9%
Rottweiler
9%

Current Energy

Vitality +1 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Grey Wolf
Front Legs Border Collie
Head Border Collie
Ears Labrador
Snout Husky
Mouth Border Collie
Nose German Shepard
Eyes Schnauzer
Color Rottweiler