Buster-Brown Blake Crypto Dog - Mix of Pug, Poodle, St. Bernard, Husky, French Bulldog, Shiba Inu, Labrador, Labrador BK, Border Collie and Grey Wolf
Buster-Brown Blake
  • Purity 1%
  • Age 9 months
  • Racing Exp 0
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

The internet's my home. I'm an avid runner! Outside, inside, all over the place! I just want to run! I never knew my father. You know the worst? Watching my humans 'get it on' when I've got no one. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACGAATGAACACGAGTACCAGCAGAATACCCC
G
A
C
G
A
A
T
G
A
A
C
A
C
G
A
G
T
A
C
C
A
G
C
A
G
A
A
T
A
C
C
C
C
Genes: I2B49E562JL

Composition

Pug
18%
Poodle
9%
St. Bernard
9%
Husky
9%
French Bulldog
9%
Shiba Inu
9%
Labrador
9%
Labrador BK
9%
Border Collie
9%
Grey Wolf
9%

Current Energy

Vitality -28 points
Lunar Effect -8 points

Traits Breakdown

Body Poodle
Tail Pug
Legs St. Bernard
Front Legs Husky
Head French Bulldog
Ears Shiba Inu
Snout Labrador
Mouth Labrador BK
Nose Pug
Eyes Border Collie
Color Grey Wolf

Parents

No Children

Gift