Mollie Meadow Digital Cryptocurrency Dog - Mix of Border Collie, Dachshund, Schnauzer, Labrador, Husky, Labrador BK and German Shepard
Mollie Meadow
  • Purity 18%
  • Age 14 months
  • Racing Exp 0
  • Border Collie 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 8
Neutral & Casual

Achievements

None

Bio

I cry whenever I hear an ambulance siren! My favorite place to sleep is under the covers between my humans. I hate it when I am not the center of attention. My bark alone scares birds out of my yard.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTACGGATACATACCAACATACGCATCATAC
T
A
C
T
A
C
G
G
A
T
A
C
A
T
A
C
C
A
A
C
A
T
A
C
G
C
A
T
C
A
T
A
C
Genes: JJAJC54J67J

Composition

Border Collie
45%
Dachshund
9%
Schnauzer
9%
Labrador
9%
Husky
9%
Labrador BK
9%
German Shepard
9%

Current Energy

Vitality -34 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Dachshund
Front Legs Border Collie
Head Schnauzer
Ears Labrador
Snout Husky
Mouth Border Collie
Nose Labrador BK
Eyes German Shepard
Color Border Collie