Pogo Precious Cryptocurrency Game Dog - Mix of Rottweiler, Shiba Inu, Yorkshire Terrier, Schnauzer, Labrador BK, Grey Wolf, Corgi, Pitbull terrier, Husky and Maltese
Pogo Precious
  • Purity 1%
  • Age 6 months
  • Racing Exp 1
  • Rottweiler 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

Greetings. My name is Pogo Precious. They say my bite is worse than my bark. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. My favorite pastime is playing tug-of-war with my human's underwear. I hate it when I am not the center of attention.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.40 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTATTACACATAGCACCCAGCTCCCACACAACC
G
T
A
T
T
A
C
A
C
A
T
A
G
C
A
C
C
C
A
G
C
T
C
C
C
A
C
A
C
A
A
C
C
Genes: EFHC6LONH4K

Composition

Rottweiler
18%
Shiba Inu
9%
Yorkshire Terrier
9%
Schnauzer
9%
Labrador BK
9%
Grey Wolf
9%
Corgi
9%
Pitbull terrier
9%
Husky
9%
Maltese
9%

Current Energy

Vitality -51 points
Lunar Effect -8 points

Traits Breakdown

Body Shiba Inu
Tail Yorkshire Terrier
Legs Rottweiler
Front Legs Schnauzer
Head Labrador BK
Ears Grey Wolf
Snout Corgi
Mouth Pitbull terrier
Nose Rottweiler
Eyes Husky
Color Maltese