Barclay Banjo Hitter Litecoin Dog - Mix of Golder Retriever, Border Collie, Grey Wolf and Dachshund
Barclay Banjo Hitter
  • Purity 52%
  • Age 10 months
  • Racing Exp 0
  • Golder Retriever 73%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 9
Depressed & Snaillike

Achievements

None

Bio

Howdy! I'm Barclay Banjo Hitter. I run exclusively on code. My favorite place to sleep is under the covers between my humans. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! I never met a leg I didn't want to hump. I just want to "share a bone"... ;)

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGAAGAAGAAGATACCCCAGAAGAGGAAGAAGA
A
G
A
A
G
A
A
G
A
A
G
A
T
A
C
C
C
C
A
G
A
A
G
A
G
G
A
A
G
A
A
G
A
Genes: 8888JL88A88

Composition

Golder Retriever
73%
Border Collie
9%
Grey Wolf
9%
Dachshund
9%

Current Energy

Vitality -11 points
Lunar Effect -26 points

Traits Breakdown

Body Golder Retriever
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Border Collie
Ears Grey Wolf
Snout Golder Retriever
Mouth Golder Retriever
Nose Dachshund
Eyes Golder Retriever
Color Golder Retriever