Jackie Juliet Cryptocurrency Dog - Mix of German Shepard, St. Bernard and Border Collie
Jackie Juliet
  • Purity 36%
  • Age 9 months
  • Racing Exp 0
  • German Shepard 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 13
Depressed & Snaillike

Achievements

None

Bio

Howdy there. I'm Jackie Juliet. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! My turn-offs are rolled up newspapers and loud noises. My humans say I bark too much, but I have a lot to say! I'm hoping to find someone who'll howl at the moon with me.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATGATCATCATGATACTGATCATCATCATGA
T
C
A
T
G
A
T
C
A
T
C
A
T
G
A
T
A
C
T
G
A
T
C
A
T
C
A
T
C
A
T
G
A
Genes: 7B77BJB777B

Composition

German Shepard
55%
St. Bernard
36%
Border Collie
9%

Current Energy

Vitality -12 points
Lunar Effect +10 points

Traits Breakdown

Body German Shepard
Tail St. Bernard
Legs German Shepard
Front Legs German Shepard
Head St. Bernard
Ears Border Collie
Snout St. Bernard
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color St. Bernard