Bridgett Baron Bitcoin Dog - Mix of German Shepard, St. Bernard and Labrador
Bridgett Baron
  • Purity 36%
  • Age 5 months
  • Racing Exp 0
  • German Shepard 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 12
Depressed & Snaillike

Achievements

None

Bio

Whatcha know, honey. Bridgett Baron here. I live inside of a web app in a big data center. I really dislike stinky flea collars. The place I like most in the world is curled up in my human's bed, hogging all the covers! I think hamsters and cats are both over-rated.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATGATCATCATGACCATGATCATCATCATGA
T
C
A
T
G
A
T
C
A
T
C
A
T
G
A
C
C
A
T
G
A
T
C
A
T
C
A
T
C
A
T
G
A
Genes: 7B77B5B777B

Composition

German Shepard
55%
St. Bernard
36%
Labrador
9%

Current Energy

Vitality -12 points
Lunar Effect +10 points

Traits Breakdown

Body German Shepard
Tail St. Bernard
Legs German Shepard
Front Legs German Shepard
Head St. Bernard
Ears Labrador
Snout St. Bernard
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color St. Bernard