Ulysses Ursula Crypto Game Dog - Pure German Shepard
Ulysses Ursula
  • Purity 100%
  • Age 6 months
  • Racing Exp 70
  • German Shepard 100%
  • Gold medal 3 Silver medal 1 Bronze medal 4
  • 23 races
  • Gen 11
Depressed & Snaillike

Achievements

Podium Champion
Speed Champion
Pro Racer

Bio

I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! My favorite way to relax is to be scratched on my belly. Let me have a pig's ear and I'm in heaven. I've been known to run with bad dogs.

Racing Stats

Ran 23 races
  • 3 1 4
 Best Time12.92 sec
No rank  RacingĀ *** LTC
34.8 % wins (8) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -21 points
Lunar Effect +24 points

Traits Breakdown

Traits 100% Purebred German Shepard