Alma Amelia Bitcoin Dog - Mix of Husky, French Bulldog and St. Bernard
Alma Amelia
  • Purity 67%
  • Age 6 months
  • Racing Exp 0
  • Husky 82%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 17
Depressed & Snaillike

Achievements

None

Bio

What's up? I'm Alma Amelia. I live in your digital dreams. The place I like most in the world is curled up in my human's bed, hogging all the covers! I don't like running outta pee when there are still so many trees. I slept with a cat and I liked it.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAACAACACGATGAACAACAACAACAACAACA
A
C
A
A
C
A
A
C
A
C
G
A
T
G
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
Genes: 4449B444444

Composition

Husky
82%
French Bulldog
9%
St. Bernard
9%

Current Energy

Vitality -14 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs French Bulldog
Head St. Bernard
Ears Husky
Snout Husky
Mouth Husky
Nose Husky
Eyes Husky
Color Husky