Barclay Blackie Crypto Dog - Mix of Husky, French Bulldog and St. Bernard
Barclay Blackie
  • Purity 67%
  • Age 10 months
  • Racing Exp 0
  • Husky 82%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 16
Depressed & Snaillike

Achievements

None

Bio

I'd like to take you for a byte to eat in cyberspace. I'll outrun you for the ball if I can...that's just how I roll. Are you into garbage cans? I am. Long or short hair works for me, just no baldies please. If you are looking for companionship without commitment, so am I.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAACAACACGATGAACAACAACAACAACAACA
A
C
A
A
C
A
A
C
A
C
G
A
T
G
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
Genes: 4449B444444

Composition

Husky
82%
French Bulldog
9%
St. Bernard
9%

Current Energy

Vitality -14 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs French Bulldog
Head St. Bernard
Ears Husky
Snout Husky
Mouth Husky
Nose Husky
Eyes Husky
Color Husky