Luke Lady Rover Crypto Dog - Mix of Husky, French Bulldog and Pitbull terrier
Luke Lady Rover
  • Purity 67%
  • Age 15 months
  • Racing Exp 0
  • Husky 82%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 13
Sad & Tardy

Achievements

None

Bio

Nice to meet you! I'm Luke Lady Rover. Virtually, I'll come whenever you call. I'm an avid runner! Outside, inside, all over the place! I just want to run! I wish I could spend every weekend going camping with my human. All the animals out there smell so funny!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAACAACACGATCCACAACAACAACAACAACA
A
C
A
A
C
A
A
C
A
C
G
A
T
C
C
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
Genes: 4449N444444

Composition

Husky
82%
French Bulldog
9%
Pitbull terrier
9%

Current Energy

Vitality -19 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs French Bulldog
Head Pitbull terrier
Ears Husky
Snout Husky
Mouth Husky
Nose Husky
Eyes Husky
Color Husky