Bond Bunky Bitcoin Game Dog - Mix of Husky, Labrador, French Bulldog and St. Bernard
Bond Bunky
  • Purity 52%
  • Age 18 months
  • Racing Exp 0
  • Husky 73%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 12
Happy & Agile

Achievements

None

Bio

I love cuddling up, doggy-style after a romantic evening. I'll be honest...Napping is my favorite so we gotta go slow. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! If I can't reach it to clean it myself, it doesn't need cleaning!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCAACAACACGATGAACAACAACAACAACAACA
C
C
A
A
C
A
A
C
A
C
G
A
T
G
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
Genes: 5449B444444

Composition

Husky
73%
Labrador
9%
French Bulldog
9%
St. Bernard
9%

Current Energy

Vitality -12 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Husky
Front Legs French Bulldog
Head St. Bernard
Ears Husky
Snout Husky
Mouth Husky
Nose Husky
Eyes Husky
Color Husky