Alvin Axel Cryptocurrency Dog - Mix of Husky, Labrador, Golder Retriever and St. Bernard
Alvin Axel
  • Purity 52%
  • Age 8 months
  • Racing Exp 0
  • Husky 73%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 11
Depressed & Snaillike

Achievements

None

Bio

They call me Alvin Axel. What's your name? I hate being left alone all day. My favorite place in the world is the dog park. So many smells! I've always had a crush on Lassie. I am looking for my best friend, lover, and equal partner to share my food bowl.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCAACAACAAGATGAACAACAACAACAACAACA
C
C
A
A
C
A
A
C
A
A
G
A
T
G
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
Genes: 5448B444444

Composition

Husky
73%
Labrador
9%
Golder Retriever
9%
St. Bernard
9%

Current Energy

Vitality -4 points
Lunar Effect +22 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Husky
Front Legs Golder Retriever
Head St. Bernard
Ears Husky
Snout Husky
Mouth Husky
Nose Husky
Eyes Husky
Color Husky