Aspen Al Bundy Litecoin Dog - Mix of Husky, Labrador, Grey Wolf, Dachshund, St. Bernard, Maltese and Poodle
Aspen Al Bundy
  • Purity 12%
  • Age 2 months
  • Racing Exp 2
  • Husky 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Someday I'm gonna breakout from inside this server. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I may need de-worming. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later!

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time16.07 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCAACACCCGGATGAACAACAACCACACCAGAC
C
C
A
A
C
A
C
C
C
G
G
A
T
G
A
A
C
A
A
C
A
A
C
C
A
C
A
C
C
A
G
A
C
Genes: 54LAB44K45I

Composition

Husky
36%
Labrador
18%
Grey Wolf
9%
Dachshund
9%
St. Bernard
9%
Maltese
9%
Poodle
9%

Current Energy

Vitality -6 points
Lunar Effect -2 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Grey Wolf
Front Legs Dachshund
Head St. Bernard
Ears Husky
Snout Husky
Mouth Maltese
Nose Husky
Eyes Labrador
Color Poodle