Nugget Norton Cryptocurrency Dog - Mix of Husky, Beagle, Pitbull terrier and French Bulldog
Nugget Norton
  • Purity 30%
  • Age 2 months
  • Racing Exp 0
  • Husky 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 11
Depressed & Snaillike

Achievements

None

Bio

Top o' the mornin' to ya! I'm Nugget Norton. I run exclusively on code. Small yappy creatures bug me...they disturb my zen. I adore sleeping upside down with my tongue hanging out! I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! You scratch my belly and I'll scratch yours ;)

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAACAACACGATCCCTAACAACATCCACAACA
C
T
A
A
C
A
A
C
A
C
G
A
T
C
C
C
T
A
A
C
A
A
C
A
T
C
C
A
C
A
A
C
A
Genes: D449ND44N44

Composition

Husky
55%
Beagle
18%
Pitbull terrier
18%
French Bulldog
9%

Current Energy

Vitality -9 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail Husky
Legs Husky
Front Legs French Bulldog
Head Pitbull terrier
Ears Beagle
Snout Husky
Mouth Husky
Nose Pitbull terrier
Eyes Husky
Color Husky