Codi Cyrus Crypto Dog - Mix of Yorkshire Terrier, Schnauzer, Shiba Inu, Corgi, Maltese and Grey Wolf
Codi Cyrus
  • Purity 29%
  • Age 3 months
  • Racing Exp 8
  • Yorkshire Terrier 55%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 2 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

A-yo...Call me Codi Cyrus. Someday I'm gonna breakout from inside this server. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! I'm looking for someone smart enough to help me find the treat stash.

Racing Stats

Ran 2 races
  • 0 1 0
 Best Time15.80 sec
No rank  RacingĀ *** LTC
50.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ATAGTAAGCACCTTATTATTACCCTTATTATTA
A
T
A
G
T
A
A
G
C
A
C
C
T
T
A
T
T
A
T
T
A
C
C
C
T
T
A
T
T
A
T
T
A
Genes: CEOKFFFLFFF

Composition

Yorkshire Terrier
55%
Schnauzer
9%
Shiba Inu
9%
Corgi
9%
Maltese
9%
Grey Wolf
9%

Current Energy

Vitality -53 points
Lunar Effect -4 points

Traits Breakdown

Body Schnauzer
Tail Shiba Inu
Legs Corgi
Front Legs Maltese
Head Yorkshire Terrier
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth Grey Wolf
Nose Yorkshire Terrier
Eyes Yorkshire Terrier
Color Yorkshire Terrier