Tasha Toby Bitcoin Dog - Mix of Yorkshire Terrier, Schnauzer, Beagle, Border Collie, Pug and Grey Wolf
Tasha Toby
  • Purity 21%
  • Age 10 months
  • Racing Exp 7
  • Yorkshire Terrier 45%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

In my digital world, cats aren't the only ones who hack. I'll eat my vomit and yours too. I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day! You know the worst? Watching my humans 'get it on' and I have to lick myself.

Racing Stats

Ran 1 races
  • 0 1 0
 Best Time16.10 sec
No rank  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ATACTATACGAATTATTATTAATATTATTACCC
A
T
A
C
T
A
T
A
C
G
A
A
T
T
A
T
T
A
T
T
A
A
T
A
T
T
A
T
T
A
C
C
C
Genes: CDJ2FFFCFFL

Composition

Yorkshire Terrier
45%
Schnauzer
18%
Beagle
9%
Border Collie
9%
Pug
9%
Grey Wolf
9%

Current Energy

Vitality -50 points
Lunar Effect +2 points

Traits Breakdown

Body Schnauzer
Tail Beagle
Legs Border Collie
Front Legs Pug
Head Yorkshire Terrier
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth Schnauzer
Nose Yorkshire Terrier
Eyes Yorkshire Terrier
Color Grey Wolf