Bobby Axelrod Digital Cryptocurrency Game Dog - Mix of Golder Retriever, Border Collie, Boxer, Yorkshire Terrier, Schnauzer, Labrador BK, Corgi and Husky
Bobby Axelrod
  • Purity 8%
  • Age 5 months
  • Racing Exp 0
  • Golder Retriever 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

I'm totally against baths! They are the worst! I love waking up early then indulging in long afternoon naps. My favorite thing is to sit in my humans' laps while they are trying to read or drive. Dragging my butt on the carpet feels so good.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AACAGATTAATATACGCAAGCACATACAGAAGA
A
A
C
A
G
A
T
T
A
A
T
A
T
A
C
G
C
A
A
G
C
A
C
A
T
A
C
A
G
A
A
G
A
Genes: G8FCJ6O4J88

Composition

Golder Retriever
27%
Border Collie
18%
Boxer
9%
Yorkshire Terrier
9%
Schnauzer
9%
Labrador BK
9%
Corgi
9%
Husky
9%

Current Energy

Vitality -40 points
Lunar Effect +8 points

Traits Breakdown

Body Boxer
Tail Golder Retriever
Legs Yorkshire Terrier
Front Legs Schnauzer
Head Border Collie
Ears Labrador BK
Snout Corgi
Mouth Husky
Nose Border Collie
Eyes Golder Retriever
Color Golder Retriever

Parents

No Children

Gift