Luna Lolita Cryptocurrency Game Dog - Mix of Border Collie, Husky, Dachshund, German Shepard, Labrador BK and Rottweiler
Luna Lolita
  • Purity 13%
  • Age 15 months
  • Racing Exp 0
  • Border Collie 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 8
Neutral & Casual

Achievements

None

Bio

Howdy potential partner! Luna Lolita here. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! I'll outrun you for the ball if I can...that's just how I roll. Size doesn't matter, I like 'em all.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTACACATACTCAGGAACATACGCAGGACAC
T
A
C
T
A
C
A
C
A
T
A
C
T
C
A
G
G
A
A
C
A
T
A
C
G
C
A
G
G
A
C
A
C
Genes: JJ4J7A4J6AH

Composition

Border Collie
36%
Husky
18%
Dachshund
18%
German Shepard
9%
Labrador BK
9%
Rottweiler
9%

Current Energy

Vitality -2 points
Lunar Effect +2 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Husky
Front Legs Border Collie
Head German Shepard
Ears Dachshund
Snout Husky
Mouth Border Collie
Nose Labrador BK
Eyes Dachshund
Color Rottweiler